Subjects, methods, and results

Between October 1994 and June 1995, four asymptomatic homosexual men positive for HIV-1 with CD4 T cell counts between 330 and 600 cells/μl participated in the study. The men had been HIV positive for 3-10 years and none was receiving anti-retroviral treatment. The patients presented with a purulent urethral discharge which developed after unprotected orogenital sex. In each case, microscopy of a Gram stained urethral smear revealed 10 or more neutrophils per high power field (x1000), and in three cases (patients 1, 2, and 4) Gram negative intracellular diplococci were identified; urethral infection with Neisseria gonorrhoea was diagnosed at presentation and subsequently confirmed by culture. Non-gonococcal urethritis was diagnosed in patient 3. Patients with gonococcal urethritis were treated with single oral doses of ciprofloxacin 500 mg (patients 1 and 4) or ampicillin 3 g with probenecid 1 g (patient 2). The patient with non-gonococcal urethritis received doxycycline 100 mg bd for seven days. Subsequent urethral samples from patients 1, 3, and 4 were non-purulent and negative on microscopy and culture. Patient 2 had a post-gonococcal urethritis with a persistent discharge which resolved when treated with a course of doxycycline. No patient had any signs or symptoms of prostatitis. Blood and semen samples were collected on the day of presentation (before treatment) and at subsequent visits.

DNA was extracted from whole blood or semen using a commercially available DNA extraction method (Digene Laboratories, Germany). Quantitative polymerase chain reaction for proviral DNA was performed using nested primers to the gag region of HIV-1 (outer primers 5' GAGGAGCCACCCCACAATATT and 5' TAGGTGGATTATTTGTCATCCA; inner primers 5' TGCTAAACACAGTTGGGGGGA and 5' CCTGAAGGGTACTAGTAGTT) and coamplification of an internal control sequence.

Figure 1 shows HIV proviral loads during the period of treatment. HIV-1 proviral load in the semen of these subjects declined (P<0.05 Mann-Whitney test) when their intercurrent sexually transmitted diseases were treated; there were no significant changes in the blood.

View larger version:

• In a new window

• Download as PowerPoint Slide

Fig 1

Fluctuations in HIV proviral loads in serial semen and blood samples from four patients

Comment

The presence of HIV in semen has been well documented,2 3 but the relation between the viral load in semen and peripheral blood CD4 counts is not a simple one.3 No studies have looked at the serial viral load of genital fluids during treatment for other sexually transmitted diseases, although a single case report has suggested that chlamydial urethritis may increase shedding of HIV-1 in the semen.4 Our results help explain how transmission of HIV may be facilitated by concomitant sexually transmitted diseases and add further support for an aggressive approach to treating sexually transmitted diseases in HIV infected patients, as a means of reducing transmission of HIV and for reinforcing the benefits of using condoms.5