- M C Atkins, research fellowa,
- E M Carlin, senior registrarb,
- V C Emery, reader in virologya,
- P D Griffiths, professor of virologya,
- F Boag, consultant physicianb
- a Department of Virology, Royal Free Hospital School of Medicine, London NW3 2QG
- b Department of Genitourinary Medicine, Royal Chelsea and Westminster Hospital, London SW10 9TH
- Correspondence to: Dr Boag.
- Accepted 24 April 1996
Most HIV infections worldwide are acquired sexually, yet most coital episodes involving an infected partner do not result in acquisition of HIV. Acquisition of HIV must depend on both the volume of secretions transferred from the infected partner (donor) and the concentration of HIV present in the secretions. However, exposure alone to such a virus inoculum is clearly insufficient to ensure transmission. The coexistence of other sexually transmitted diseases in either the recipient or donor could potentially increase the risk of transmission by causing genital ulcers or by releasing inflammatory cytokines which increase HIV replication.1
We measured the HIV load in the semen and blood of HIV infected patients presenting with acute sexually transmitted diseases to determine if viral load in semen decreases when patients receive specific treatment for sexually transmitted diseases.
Subjects, methods, and results
Between October 1994 and June 1995, four asymptomatic homosexual men positive for HIV-1 with CD4 T cell counts between 330 and 600 cells/μl participated in the study. The men had been HIV positive for 3-10 years and none was receiving anti-retroviral treatment. The patients presented with a purulent urethral discharge which developed after unprotected orogenital sex. In each case, microscopy of a Gram stained urethral smear revealed 10 or more neutrophils per high power field (x1000), and in three cases (patients 1, 2, and 4) Gram negative intracellular diplococci were identified; urethral infection with Neisseria gonorrhoea was diagnosed at presentation and subsequently confirmed by culture. Non-gonococcal urethritis was diagnosed in patient 3. Patients with gonococcal urethritis were treated with single oral doses of ciprofloxacin 500 mg (patients 1 and 4) or ampicillin 3 g with probenecid 1 g (patient 2). The patient with non-gonococcal urethritis received doxycycline 100 mg bd for seven days. Subsequent urethral samples from patients 1, 3, and 4 were non-purulent and negative on microscopy and culture. Patient 2 had a post-gonococcal urethritis with a persistent discharge which resolved when treated with a course of doxycycline. No patient had any signs or symptoms of prostatitis. Blood and semen samples were collected on the day of presentation (before treatment) and at subsequent visits.
DNA was extracted from whole blood or semen using a commercially available DNA extraction method (Digene Laboratories, Germany). Quantitative polymerase chain reaction for proviral DNA was performed using nested primers to the gag region of HIV-1 (outer primers 5' GAGGAGCCACCCCACAATATT and 5' TAGGTGGATTATTTGTCATCCA; inner primers 5' TGCTAAACACAGTTGGGGGGA and 5' CCTGAAGGGTACTAGTAGTT) and coamplification of an internal control sequence.
Figure 1 shows HIV proviral loads during the period of treatment. HIV-1 proviral load in the semen of these subjects declined (P<0.05 Mann-Whitney test) when their intercurrent sexually transmitted diseases were treated; there were no significant changes in the blood.
Comment
The presence of HIV in semen has been well documented,2 3 but the relation between the viral load in semen and peripheral blood CD4 counts is not a simple one.3 No studies have looked at the serial viral load of genital fluids during treatment for other sexually transmitted diseases, although a single case report has suggested that chlamydial urethritis may increase shedding of HIV-1 in the semen.4 Our results help explain how transmission of HIV may be facilitated by concomitant sexually transmitted diseases and add further support for an aggressive approach to treating sexually transmitted diseases in HIV infected patients, as a means of reducing transmission of HIV and for reinforcing the benefits of using condoms.5
Footnotes
-
Funding Part of this work was supported by the UK Medical Research Council and by the St Stephens AIDS Trust.
-
Conflict of interest None.








CiteULike
Connotea
Del.icio.us
Digg
Facebook
Mendeley
Reddit
Technorati
Twitter
Stumbleupon
Rapid responses
Latest Responses
Re: Bringing Nightingale down to size
Published 29 May 2012
Re: Avoid antimuscarinic drugs in people with dementia
Published 29 May 2012
Re: Strengthening primary health care: Related to the integration of medical training, community service need and health administration
Published 29 May 2012
Re: Strengthening primary health care: Related to the integration of medical training, community service need and health administration
Published 29 May 2012
Health Literacy: Patient involvement and engagement with healthcare
Published 29 May 2012
Most responses
Venous thrombosis in users of non-oral hormonal contraception: follow-up study, Denmark 2001-10 (12 responses)
Published 10 May 2012 - 23:32
The psychiatric oligarchs who medicalise normality (9 responses)
Published 2 May 2012 - 15:42
Are doctors justified in taking industrial action in defence of their pensions? No (8 responses)
Published 8 May 2012 - 12:21
Are doctors justified in taking industrial action in defence of their pensions? Yes (8 responses)
Published 8 May 2012 - 12:21
The hardest thing: admitting error (7 responses)
Published 2 May 2012 - 12:27