Papers

Fluctuations of HIV load in semen of HIV positive patients with newly acquired sexually transmitted diseases

^a Department of Virology, Royal Free Hospital School of Medicine, London NW3 2QG, ^b Department of Genitourinary Medicine, Royal Chelsea and Westminster Hospital, London SW10 9TH

Correspondence to: Dr Boag.

Most HIV infections worldwide are acquired sexually, yet most coital episodes involving an infected partner do not result in acquisition of HIV. Acquisition of HIV must depend on both the volume of secretions transferred from the infected partner (donor) and the concentration of HIV present in the secretions. However, exposure alone to such a virus inoculum is clearly insufficient to ensure transmission. The coexistence of other sexually transmitted diseases in either the recipient or donor could potentially increase the risk of transmission by causing genital ulcers or by releasing inflammatory cytokines which increase HIV replication.¹

We measured the HIV load in the semen and blood of HIV infected patients presenting with acute sexually transmitted diseases to determine if viral load in semen decreases when patients receive specific treatment for sexually transmitted diseases.

Subjects, methods, and results

Between October 1994 and June 1995, four asymptomatic homosexual men positive for HIV-1 with CD4 T cell counts between 330 and 600 cells/µl participated in the study. The men had been HIV positive for 3-10 years and none was receiving anti-retroviral treatment. The patients presented with a purulent urethral discharge which developed after unprotected orogenital sex. In each case, microscopy of a Gram stained urethral smear revealed 10 or more neutrophils per high power field (x1000), and in three cases (patients 1, 2, and 4) Gram negative intracellular diplococci were identified; urethral infection with Neisseria gonorrhoea was diagnosed at presentation and subsequently confirmed by culture. Non-gonococcal urethritis was diagnosed in patient 3. Patients with gonococcal urethritis were treated with single oral doses of ciprofloxacin 500 mg (patients 1 and 4) or ampicillin 3 g with probenecid 1 g (patient 2). The patient with non-gonococcal urethritis received doxycycline 100 mg bd for seven days. Subsequent urethral samples from patients 1, 3, and 4 were non-purulent and negative on microscopy and culture. Patient 2 had a post-gonococcal urethritis with a persistent discharge which resolved when treated with a course of doxycycline. No patient had any signs or symptoms of prostatitis. Blood and semen samples were collected on the day of presentation (before treatment) and at subsequent visits.

DNA was extracted from whole blood or semen using a commercially available DNA extraction method (Digene Laboratories, Germany). Quantitative polymerase chain reaction for proviral DNA was performed using nested primers to the gag region of HIV-1 (outer primers 5' GAGGAGCCACCCCACAATATT and 5' TAGGTGGATTATTTGTCATCCA; inner primers 5' TGCTAAACACAGTTGGGGGGA and 5' CCTGAAGGGTACTAGTAGTT) and coamplification of an internal control sequence.

Figure 1 shows HIV proviral loads during the period of treatment. HIV-1 proviral load in the semen of these subjects declined (P<0.05 Mann-Whitney test) when their intercurrent sexually transmitted diseases were treated; there were no significant changes in the blood.

View larger version (21K): [in this window] [in a new window]   Fig 1--Fluctuations in HIV proviral loads in serial semen and blood samples from four patients

Comment

The presence of HIV in semen has been well documented,^{2 3} but the relation between the viral load in semen and peripheral blood CD4 counts is not a simple one.³ No studies have looked at the serial viral load of genital fluids during treatment for other sexually transmitted diseases, although a single case report has suggested that chlamydial urethritis may increase shedding of HIV-1 in the semen.⁴ Our results help explain how transmission of HIV may be facilitated by concomitant sexually transmitted diseases and add further support for an aggressive approach to treating sexually transmitted diseases in HIV infected patients, as a means of reducing transmission of HIV and for reinforcing the benefits of using condoms.⁵

Funding: Part of this work was supported by the UK Medical Research Council and by the St Stephens AIDS Trust.

Conflict of interest: None.

1. Gaynor R. Cellular transcription factors involved in the regulation of HIV-1 gene expression. AIDS 1992;6:347-63. [Medline]
2. Zagury D, Bernard J, Leibowitch J, Groopman JE, Feldman M, Gallo RC. HTLV-III in cells cultured from semen of two patients with AIDS. Science 1984;226:449-51. [Abstract/Free Full Text]
3. Vernazza PL, Eron JJ, Cohen MS, van der Horst CM, Troiani L, Fiscus SA. Detection and biological characterization of infectious HIV-1 in semen of seropositive men. AIDS 1994;8:1325-9. [Medline]
4. Eron J, Gilliam B, Fiscus S, Dyer J, Cohen MS. HIV-1 shedding and chlamydia urethritis. JAMA 1996;275:38.
5. Grosskurth H, Mosha F, Todd E, Murijarubi E, Klokke A, Senkoro K, et al. Impact of improved treatment of sexually-transmitted diseases on HIV-1 infection in rural Tanzania: randomized controlled trial. Lancet 1995;346:530-6. [Medline]

CiteULike    Complore    Connotea    Del.icio.us    Digg    Reddit    StumbleUpon    Technorati    What's this?

This article has been cited by other articles:

• Klimas, N., Koneru, A. O., Fletcher, M. A. (2008). Overview of HIV. Psychosom. Med. 70: 523-530 [Abstract] [Full text]  
• Temoshok, L. R., Wald, R. L. (2008). Integrating Multidimensional HIV Prevention Programs Into Healthcare Settings. Psychosom. Med. 70: 612-619 [Abstract] [Full text]  
• Fabrizio, A.-L., Vitantonio, D. B., Enrica, T., Andrea, D. C., Fabio, M., Lucia, A., Caterina, P., Nadia, C., Grazia, D. D. M., Carmela, N., Angela, D., Alberto, B., Mario, M., Aldo, P. (2006). Early textural and functional alterations of left ventricular myocardium in mild hypothyroidism.. Eur J Endocrinol 155: 3-9 [Abstract] [Full text]  
• Sadiq, S T, Taylor, S, Copas, A J, Bennett, J, Kaye, S, Drake, S M, Kirk, S, Pillay, D, Weller, I V D (2005). The effects of urethritis on seminal plasma HIV-1 RNA loads in homosexual men not receiving antiretroviral therapy. Sex. Transm. Infect. 81: 120-123 [Abstract] [Full text]  
• Bello, V. D., Giorgi, D., Viacava, P., Enrica, T., Nardi, C., Palagi, C., Donne, M. G. D., Verunelli, F., Mariani, M. A., Grandjean, J., Dell'Anna, R., Di Cori, A., Zucchelli, G., Romano, M. F., Mariani, M. (2004). Severe Aortic Stenosis and Myocardial Function: Diagnostic and Prognostic Usefulness of Ultrasonic Integrated Backscatter Analysis. Circulation 110: 849-855 [Abstract] [Full text]  
• Butt, A. M, Johnman, C, Nandwani, R (2001). Sexually transmitted infections in people with HIV infection. BMJ 322: 796-796 [Full text]  
• Royce, R. A., Sena, A., Cates, W., Cohen, M. S. (1997). Sexual Transmission of HIV. NEJM 336: 1072-1078 [Full text]